ClinVar Preview
Overview
ClinVar is a freely accessible, public archive of reports of the relationships among human variations and phenotypes, with supporting evidence. ClinVar thus facilitates access to and communication about the relationships asserted between human variation and observed health status, and the history of that interpretation.
Publication
Melissa J Landrum, Jennifer M Lee, Mark Benson, Garth R Brown, Chen Chao, Shanmuga Chitipiralla, Baoshan Gu, Jennifer Hart, Douglas Hoffman, Wonhee Jang, Karen Karapetyan, Kenneth Katz, Chunlei Liu, Zenith Maddipatla, Adriana Malheiro, Kurt McDaniel, Michael Ovetsky, George Riley, George Zhou, J Bradley Holmes, Brandi L Kattman, Donna R Maglott, ClinVar: improving access to variant interpretations and supporting evidence, Nucleic Acids Research, 46, Issue D1, 4 January 2018, Pages D1062–D1067, https://doi.org/10.1093/nar/gkx1153
ClinVar Preview relates to the new ClinVar XML format introduced in 2024. Following sections describe the parsing and subsequent json format provided by Illumina Connected Annotations.
Parsing
ClinVar recommends using the VCV XML file because it contains comprehensive information.
Parsing is simplified by using the XSD file generation. Command for generating XSD file
xsd ClinVar_VCV.xsd /n:VariationArchive /c
Overall XML to JSON mapping
| key | type | description | XML path |
|---|---|---|---|
variantType | string | sequence ontology | VariationArchive.VariationType |
accession | string | VCV Id from ClinVar | VariationArchive.Accession |
version | string | VCV Id version | VariationArchive.Version |
recordType | string | classified | VariationArchive.RecordType |
dateLastUpdated | date time | date VCV was last updated | VariationArchive.DateLastUpdated |
chromosome | string | chromosome (large variants only) | VariationArchive.ClassifiedRecord.SimpleAllele.Location.SequenceLocation.Chr |
begin | number | start position of the variant (large variants only) | VariationArchive.ClassifiedRecord.SimpleAllele.Location.SequenceLocation.positionVCF |
end | number | end position of the variant (large variants only) | VariationArchive.ClassifiedRecord.SimpleAllele.Location.SequenceLocation.displayStop or calculated |
refAllele | string | reference alleles (small variants only) | VariationArchive.ClassifiedRecord.SimpleAllele.Location.SequenceLocation.referenceAlleleVCF |
altAllele | string | alternate alleles (small variants only) | VariationArchive.ClassifiedRecord.SimpleAllele.Location.SequenceLocation.alternateAlleleVCF |
rcvs | list | list of RCV objects | VariationArchive.ClassifiedRecord.RCVList |
classifications | list | list of classification objects | VariationArchive.ClassifiedRecord.Classifications |
clinicalAssertions | list | list of clinicalAssertion objects | VariationArchive.ClassifiedRecord.ClinicalAssertionList |
Variation fields
XML
<VariationArchive
VariationID="1381081"
VariationName="NM_003000.3(SDHB):c.19_41dup (p.Pro14_Ala15insSerProTer)"
VariationType="Indel"
Accession="VCV001381081"
Version="3"
RecordType="classified"
DateLastUpdated="2024-01-26"
NumberOfSubmissions="1"
NumberOfSubmitters="1"
DateCreated="2022-03-28"
MostRecentSubmission="2023-02-07"
>
...
JSON
{
"variantType": "delins",
"accession": "VCV001381081",
"version": "3",
"recordType": "classified",
"dateLastUpdated": "2024-01-26",
...
}
Location fields
<SimpleAllele
AlleleID="196495"
VariationID="1381081"
>
<Location>
<CytogeneticLocation>1p36.13</CytogeneticLocation>
<SequenceLocation
Accession="NC_000001.11"
Chr="1"
Assembly="GRCh38"
positionVCF="17053978"
referenceAlleleVCF="C"
alternateAlleleVCF="CGGCAACCGGCGCCTCAAGGAGAG"
display_start="17053978"
display_stop="17053979"
AssemblyAccessionVersion="GCF_000001405.38"
forDisplay="true"
AssemblyStatus="current"
start="17053978"
stop="17053979"
variantLength="23"
/>
<SequenceLocation Assembly="GRCh37" AssemblyAccessionVersion="GCF_000001405.25"
AssemblyStatus="previous" Chr="1" Accession="NC_000001.10" start="17380473"
stop="17380474" display_start="17380473" display_stop="17380474"
variantLength="23" positionVCF="17380473" referenceAlleleVCF="C"
alternateAlleleVCF="CGGCAACCGGCGCCTCAAGGAGAG"/>
</Location>
...
</SimpleAllele>
JSON Small Variant
note the alleles are trimmed
{
"altAllele": "GGCAACCGGCGCCTCAAGGAGAG",
"refAllele": "-",
...
}
JSON Large Variant
{
"chromosome": "17",
"begin": 150732,
"end": 14764202,
...
}
RCVs
RCV Object from XML path VariationArchive.ClassifiedRecord.RCVList
| key | type | description | XML sub-path |
|---|---|---|---|
accession | string | VCV Id from ClinVar | RCVList.RCVAccession.Accession |
version | string | VCV Id version | RCVList.RCVAccession.Accession |
classifications | list | list of classification objects | RCVList.RCVAccession.RCVClassifications |
classifiedConditions | list | list of classified conditions | RCVList.RCVAccession.ClassifiedConditionList |
XML
<RCVList>
<RCVAccession
Title="NM_003000.3(SDHB):c.19_41dup (p.Pro14_Ala15insSerProTer) AND multiple conditions"
Accession="RCV001921860"
Version="3">
<ClassifiedConditionList TraitSetID="23696">
...
</ClassifiedConditionList>
<RCVClassifications>
...
</RCVClassifications>
</RCVAccession>
</RCVList>
...
JSON
{
"rcvs": [
{
"accession": "RCV001921860",
"version": "3",
"classifications": {
...
},
"classifiedConditions": [
...
]
}
]
}
Classifications
Classification object from XML path VariationArchive.ClassifiedRecord.RCVList.RCVAccession.RCVClassifications
classification can be of following types:
germlineClassificationsomaticClinicalImpactoncogenicityClassification
Germline Classification
Classification object from XML path VariationArchive.ClassifiedRecord.RCVList.RCVAccession.RCVClassifications.GermlineClassification
| key | type | description | XML sub-path |
|---|---|---|---|
reviewStatus | string | review status | GermlineClassification.ReviewStatus |
descriptions | list | list of classification objects | GermlineClassification.Description |
descriptions[].classification | string | classification | GermlineClassification.Description.Value |
descriptions[].dateLastEvaluated | date | date last evaluated | GermlineClassification.Description.DateLastEvaluated |
XML
<RCVClassifications>
<GermlineClassification>
<ReviewStatus>criteria provided, single submitter</ReviewStatus>
<Description DateLastEvaluated="2021-08-04" SubmissionCount="1">Pathogenic</Description>
</GermlineClassification>
</RCVClassifications>
JSON
{
"classifications": {
"germlineClassification": {
"reviewStatus": "criteria provided, single submitter",
"descriptions": [
{
"dateLastEvaluated": "2021-08-04",
"classification": "Pathogenic"
}
]
}
}
}
Classified Conditions
Classified conditions object from XML path VariationArchive.ClassifiedRecord.RCVList.RCVAccession.ClassifiedConditionList
| key | type | description | XML sub-path |
|---|---|---|---|
condition | string | VCV Id from ClinVar | ClassifiedConditionList.ClassifiedCondition.Value |
db | string | list of classification objects | ClassifiedConditionList.ClassifiedCondition.DB |
id | string | classification | ClassifiedConditionList.ClassifiedCondition.ID |
XML
<ClassifiedConditionList TraitSetID="23696">
<ClassifiedCondition DB="MedGen" ID="C0238198">Gastrointestinal stromal tumor</ClassifiedCondition>
<ClassifiedCondition DB="MedGen" ID="C1861848">Paragangliomas 4</ClassifiedCondition>
<ClassifiedCondition DB="MedGen" ID="C0031511">Pheochromocytoma</ClassifiedCondition>
</ClassifiedConditionList>
JSON
{
"classifiedConditions": [
{
"condition": "Gastrointestinal stromal tumor",
"db": "MedGen",
"id": "C0238198"
},
{
"condition": "Paragangliomas 4",
"db": "MedGen",
"id": "C1861848"
},
{
"condition": "Pheochromocytoma",
"db": "MedGen",
"id": "C0031511"
}
]
}
Classifications
Classification object from XML path VariationArchive.ClassifiedRecord.Classifications
classification can be of following types:
germlineClassificationsomaticClinicalImpactoncogenicityClassification
XML
<Classifications>
<GermlineClassification DateLastEvaluated="2021-08-04" NumberOfSubmissions="1" NumberOfSubmitters="1"
DateCreated="2022-03-28" MostRecentSubmission="2023-02-07">
...
</GermlineClassification>
</Classifications>
JSON
"classifications": {
"germlineClassification": {...}
}
Germline Classification
Classification object from XML path VariationArchive.ClassifiedRecord.Classifications.GermlineClassification
| key | type | description | XML sub-path |
|---|---|---|---|
classification | string | classification | GermlineClassification.Description |
reviewStatus | string | review status | GermlineClassification.ReviewStatus |
dateLastEvaluated | date | date last evaluated | GermlineClassification.DateLastEvaluated |
mostRecentSubmission | date | date last evaluated | GermlineClassification.MostRecentSubmission |
pubMedIds | list | list of PubMedIds | GermlineClassification.Citation.ID.Value |
conditions | list | list of conditions | GermlineClassification.ConditionList |
XML
<Classifications>
<GermlineClassification DateLastEvaluated="2021-08-04" NumberOfSubmissions="1" NumberOfSubmitters="1"
DateCreated="2022-03-28" MostRecentSubmission="2023-02-07">
<ReviewStatus>criteria provided, single submitter</ReviewStatus>
<Description>Pathogenic</Description>
<Citation Type="general">
<ID Source="PubMed">19454582</ID>
</Citation>
<Citation Type="general">
<ID Source="PubMed">19802898</ID>
</Citation>
<ConditionList>
...
</ConditionList>
</GermlineClassification>
</Classifications>
JSON
{
"classifications": {
"germlineClassification": {
"classification": "Pathogenic",
"reviewStatus": "criteria provided, single submitter",
"dateLastEvaluated": "2021-08-04",
"mostRecentSubmission": "2023-02-07",
"conditions": [...],
"pubMedIds": [
"19454582",
"19802898"
]
}
}
}
Conditions
Conditions object from XML path VariationArchive.ClassifiedRecord.Classifications.GermlineClassification.ConditionList
| key | type | description | XML sub-path |
|---|---|---|---|
type | string | classification | ConditionList.TraitSet.Type |
contributesToAggregateClassification | True or blank | contributes to aggregate classifcation | ConditionList.TraitSet.ContributesToAggregateClassification |
traits | list | trait objects | ConditionList.TraitSet.Trait |
traits[].id | date | date last evaluated | ConditionList.TraitSet.Trait |
traits[].name | object | trait name object | ConditionList.TraitSet.Trait |
traits[].name.value | string | preferred trait name | ConditionList.TraitSet.Trait.Name.ElementValue.Type |
traits[].name.xRefs | list | list of cross references | ConditionList.TraitSet.Trait.Name.XRef |
traits[].name.xRefs[].db | string | preferred name cross reference database | ConditionList.TraitSet.Trait.Name.XRef.DB |
traits[].name.xRefs[].id | string | preferred name cross reference identifier | ConditionList.TraitSet.Trait.Name.XRef.ID |
XML
<Classifications>
<GermlineClassification DateLastEvaluated="2021-08-04" NumberOfSubmissions="1" NumberOfSubmitters="1"
DateCreated="2022-03-28" MostRecentSubmission="2023-02-07">
<ConditionList>
<TraitSet ID="23696" Type="Disease" ContributesToAggregateClassification="true">
<Trait ID="3796" Type="Disease">
<Name>
<ElementValue Type="Preferred">Pheochromocytoma</ElementValue>
<XRef ID="Pheochromocytoma/5718" DB="Genetic Alliance"/>
<XRef ID="HP:0002666" DB="Human Phenotype Ontology"/>
<XRef ID="MONDO:0008233" DB="MONDO"/>
</Name>
<Name>
<ElementValue Type="Alternate">Chromaffinoma</ElementValue>
</Name>
...
</Trait>
</TraitSet>
</ConditionList>
</GermlineClassification>
</Classifications>
JSON
{
"classifications": {
"germlineClassification": {
"classification": "Pathogenic",
"reviewStatus": "criteria provided, single submitter",
"dateLastEvaluated": "2021-08-04",
"mostRecentSubmission": "2023-02-07",
"conditions": [
{
"type": "Disease",
"contributesToAggregateClassification": true,
"traits": [
{
"id": "3796",
"name": {
"xRefs": [
{
"db": "Genetic Alliance",
"id": "Pheochromocytoma/5718"
},
{
"db": "Human Phenotype Ontology",
"id": "HP:0002666"
},
{
"db": "MONDO",
"id": "MONDO:0008233"
}
],
"value": "Pheochromocytoma"
}
}
]
}
],
"pubMedIds": [
"19454582",
"19802898"
]
}
}
}
Clinical Assertions
Conditions object from XML path VariationArchive.ClassifiedRecord.ClinicalAssertionList
| key | type | description | XML sub-path |
|---|---|---|---|
accession | string | SCV Id from ClinVar | ClinicalAssertionList.ClinVarAccession.Accession |
pubMedIds | list | list of PubMedIds | ClinicalAssertionList.ClinicalAssertion.AttributeSet.Citation.ID.Value |
XML
<ClinicalAssertionList>
<ClinicalAssertion ID="4172562" SubmissionDate="2023-01-11" DateLastUpdated="2023-02-07"
DateCreated="2022-03-28">
<ClinVarSubmissionID localKey="12475853|MedGen:C0238198;C1861848;C0031511"
submittedAssembly="GRCh37"/>
<ClinVarAccession
Accession="SCV002152762"
DateUpdated="2023-02-07"
DateCreated="2022-03-28"
Type="SCV"
Version="2"
SubmitterName="Invitae"
OrgID="500031"
OrganizationCategory="laboratory"
OrgAbbreviation="Invitae"
/>
<RecordStatus>current</RecordStatus>
<Classification DateLastEvaluated="2021-08-04">
...
</Classification>
<Assertion>variation to disease</Assertion>
<AttributeSet>
<Attribute Type="AssertionMethod">Invitae Variant Classification Sherloc (09022015)</Attribute>
<Citation>
<ID Source="PubMed">28492532</ID>
</Citation>
</AttributeSet>
<ObservedInList>
...
</ObservedInList>
<SimpleAllele>
...
</SimpleAllele>
<TraitSet Type="Disease">
...
</TraitSet>
<SubmissionNameList>
...
</SubmissionNameList>
</ClinicalAssertion>
</ClinicalAssertionList>
JSON
{
"clinicalAssertions": [
{
"accession": "SCV002152762",
"pubMedIds": [
"28492532"
]
}
]
}
Known Issues
Known Issues
Entries with following missing/incorrect information are skipped
- Invalid Ref Allele (example
VCV000437934) - Invalid Alt Allele (example
VCV000006637) - Following variant types are not supported:
Variation(exampleVCV000001101)fusion(exampleVCV000015269)unknown(exampleVCV000017564)protein only(exampleVCV000132152)Complex(exampleVCV000221337)Translocation(exampleVCV000267801)no_sequence_alteration(exampleVCV000010504)
- Only records of type
classifiedare included [VCV with typeincludedis skipped (exampleVCV000431749)] - Records with missing genomic location are skipped (example
VCV000000254)
Download URLs
https://ftp.ncbi.nlm.nih.gov/pub/clinvar/xml/ClinVarVCVRelease_00-latest.xml.gz
JSON Output
small variants:
{
"clinvar-preview": [
{
"altAllele": "A",
"refAllele": "G",
"variantType": "SNV",
"accession": "VCV000437934",
"version": "1",
"recordType": "classified",
"dateLastUpdated": "2023-08-06",
"rcvs": [
{
"accession": "RCV000505090",
"version": "1",
"classifications": {
"germlineClassification": {
"reviewStatus": "no assertion criteria provided",
"descriptions": [
{
"dateLastEvaluated": "2016-08-31",
"classification": "Pathogenic"
}
]
}
},
"classifiedConditions": [
{
"condition": "Cleidocranial dysostosis",
"db": "MedGen",
"id": "C0008928"
}
]
}
],
"classifications": {
"germlineClassification": {
"reviewStatus": "no assertion criteria provided",
"classification": "Pathogenic",
"dateLastEvaluated": "2016-08-31",
"mostRecentSubmission": "2017-09-09",
"conditions": [
{
"type": "Disease",
"contributesToAggregateClassification": true,
"traits": [
{
"id": "820",
"name": {
"xRefs": [
{
"db": "Genetic Alliance",
"id": "Cleidocranial+Dysplasia/1683"
},
{
"db": "SNOMED CT",
"id": "65976001"
}
],
"value": "Cleidocranial dysostosis"
}
}
]
}
]
}
},
"clinicalAssertions": [
{
"accession": "SCV000598565"
}
]
}
]
}
large variants:
{
"clinvar-preview": [
{
"chromosome": "17",
"begin": 150732,
"end": 14764202,
"variantType": "copy_number_gain",
"accession": "VCV000154089",
"version": "2",
"recordType": "classified",
"dateLastUpdated": "2023-10-15",
"rcvs": [
{
"accession": "RCV000142236",
"version": "6",
"classifications": {
"germlineClassification": {
"reviewStatus": "no assertion criteria provided",
"descriptions": [
{
"dateLastEvaluated": "2014-03-10",
"classification": "Pathogenic"
}
]
}
},
"classifiedConditions": [
{
"condition": "See cases"
}
]
}
],
"classifications": {
"germlineClassification": {
"reviewStatus": "no assertion criteria provided",
"classification": "Pathogenic",
"dateLastEvaluated": "2014-03-10",
"mostRecentSubmission": "2015-07-13",
"conditions": [
{
"type": "PhenotypeInstruction",
"contributesToAggregateClassification": true,
"traits": [
{
"id": "18728",
"name": {
"value": "See cases"
}
}
]
}
]
}
},
"clinicalAssertions": [
{
"accession": "SCV000183512"
}
]
}
]
}
| Field | Type | Notes |
|---|---|---|
| chromosome | string | Chromosome |
| begin | integer | start position of variant |
| end | integer | end of position of variant |
| refAllele | string | |
| altAllele | string | |
| accession | string | ClinVar ID |
| version | string | ClinVar version |
| variantType | string | variant type |
| recordType | string | record type |
| dateLastUpdated | string | yyyy-MM-dd |
| rcvs | array | RCV objects associated to this VCV |
| classifications | array | classifications for this VCV |
| clinicalAssertions | array | SCV objects associated to this VCV |
| isAlleleSpecific | bool | true when the current variant alternate allele matches the ClinVar alternate allele |
Variant Types
- copy_number_gain
- copy_number_loss
- deletion
- delins
- duplication
- insertion
- inversion
- SNV
- tandem_duplication
Review Statuses
- criteria provided, conflicting classifications
- criteria provided, multiple submitters, no conflicts
- criteria provided, single submitter
- no assertion criteria provided
- no classification provided
- practice guideline
- reviewed by expert panel
classification
- Benign
- Likely benign
- Pathogenic
- Uncertain significance
- Likely pathogenic
- Benign/Likely benign
- not provided
- conflicting data from submitters
- Pathogenic/Likely pathogenic
- association
- Conflicting classifications of pathogenicity
- Pathogenic; risk factor
- risk factor
- other
- drug response
- Uncertain significance; Pathogenic/Likely pathogenic
- Likely pathogenic, low penetrance
- Pathogenic; Affects
- Pathogenic, low penetrance
- protective
- Affects
- Benign; other
- Conflicting classifications of pathogenicity; other
- Conflicting classifications of pathogenicity; association
- Uncertain risk allele
- Uncertain significance; risk factor
- Likely pathogenic; risk factor
- Likely benign; association
- Likely risk allele
- Pathogenic/Likely pathogenic; other
- Pathogenic; other
- Pathogenic/Likely pathogenic/Pathogenic, low penetrance
- Pathogenic/Likely pathogenic; risk factor
- Benign/Likely benign; risk factor
- Uncertain significance/Uncertain risk allele
- Pathogenic; association; protective
- protective; risk factor
- Benign/Likely benign; other; risk factor
- Benign/Likely benign; association
- Benign; association
- Affects; association; other
- Pathogenic; protective
- Conflicting classifications of pathogenicity; drug response; other
- Conflicting classifications of pathogenicity; drug response
- Benign; drug response
- Likely pathogenic; other
- Conflicting classifications of pathogenicity; protective
- Pathogenic/Likely pathogenic; drug response
- Benign/Likely benign; other
- Likely pathogenic/Likely risk allele
- Uncertain risk allele; protective
- association not found
- Affects; association
- Uncertain significance; association
- Likely benign; other
- Uncertain significance; other
- Conflicting classifications of pathogenicity; association; risk factor Pathogenic;
- association
- Benign; risk factor
- Conflicting classifications of pathogenicity; other; risk factor
- Pathogenic/Likely risk allele; risk factor
- Uncertain significance; drug response
- Conflicting classifications of pathogenicity; risk factor
- other; risk factor
- Pathogenic/Likely pathogenic/Likely risk allele
- Likely pathogenic; drug response
- Conflicting classifications of pathogenicity; Affects
- association; drug response; risk factor
- Pathogenic; drug response
- Affects; risk factor
- Pathogenic; drug response; other
- Likely pathogenic; protective
- confers sensitivity
- Likely pathogenic; association
- Benign; Affects
- Likely pathogenic; Affects
- Uncertain risk allele; risk factor
- drug response; risk factor
- Pathogenic/Likely risk allele
- Likely benign; drug response; other
- Benign/Likely benign; drug response
- Benign/Likely benign; drug response; other
- drug response; other
- association; drug response
- Pathogenic; confers sensitivity
- association; risk factor
- Pathogenic/Pathogenic, low penetrance; other
- Benign; confers sensitivity
- confers sensitivity; other
- Likely pathogenic/Pathogenic, low penetrance
- Likely benign; risk factor
Building the supplementary files
There are 2 ways of building your own OMIM supplementary files using SAUtils.
The first way is to use SAUtils command's subcommands clinvar.
The ClinVar .nsa and .nsi for Illumina Connected Annotations can be built using the SAUtils command's clinvar subcommand.
The second way is to use SAUtils command's subcommands AutoDownloadGenerate. To use AutoDownloadGenerate, read more in SAUtils section.
Using clinvar subcommands and source data files
Two input .xml files and a .version file are required in order to build the .nsa and .nsi file. You should have the following files:
ClinVarVCVRelease_00-latest.xml.gz
ClinVarVCVRelease_00-latest.xml.gz.version
The version file is a json file with the following format.
{
"name": "ClinVar",
"version": "20240501",
"description": "A freely accessible, public archive of reports of the relationships among human variations and phenotypes, with supporting evidence",
"releaseDate": "2024-05-01"
}
You have to adjust the version and release date according to the actual date of the ClinVar.
Here is a sample execution:
dotnet SAUtils ClinVarPreview \
--r ~/References/7/Homo_sapiens.GRCh38.Nirvana.dat\
--vcv ClinVarVCVRelease_00-latest.xml.gz\
--o output
---------------------------------------------------------------------------
SAUtils (c) 2024 Illumina, Inc.
3.25.0
---------------------------------------------------------------------------
Parsing XML completed in 14.7 mins.
Sorting and adjusting completed in 4.7 mins.
Writing 2351609 Small Varaints
Chromosome 1 completed in 00:00:57.1
Chromosome 2 completed in 00:01:30.8
Chromosome 3 completed in 00:00:32.9
Chromosome 4 completed in 00:00:21.2
Chromosome 5 completed in 00:00:31.7
Chromosome 6 completed in 00:00:34.6
Chromosome 7 completed in 00:00:27.9
Chromosome 8 completed in 00:00:17.9
Chromosome 9 completed in 00:00:34.0
Chromosome 10 completed in 00:00:26.6
Chromosome 11 completed in 00:00:35.4
Chromosome 12 completed in 00:00:31.5
Chromosome 13 completed in 00:00:22.7
Chromosome 14 completed in 00:00:22.7
Chromosome 15 completed in 00:00:23.7
Chromosome 16 completed in 00:00:39.6
Chromosome 17 completed in 00:00:46.7
Chromosome 18 completed in 00:00:10.2
Chromosome 19 completed in 00:00:32.9
Chromosome 20 completed in 00:00:10.7
Chromosome 21 completed in 00:00:05.3
Chromosome 22 completed in 00:00:11.0
Chromosome X completed in 00:00:19.6
Chromosome Y completed in 00:00:00.1
Chromosome MT completed in 00:00:00.3
Maximum bp shifted for any variant:1
NSA writing completed in 11.5 mins.
Writing 76122 Large Varaints
Writing 76122 intervals to database...
NSI writing completed in 1.1 mins.
Time: 00:32:10.9
Process finished with exit code 0.